BBa_J31014 1 BBa_J31014 crRNA 2007-12-17T12:00:00Z 2015-08-31T04:08:45Z Generated by primer dimer PCR (see Erin Zwack's OWW page for the protocol). The original sequence is a slightly modified version of Isaacs et al.'s riboregulator crRNA. short sequence that is inserted in front of a coding region without an RBS as the part includes an RBS. When in front of the sequence and no taRNA is present, the transcript will not be translated. false false _61_ 0 918 61 Not in stock false The Xba/SpeI scar became the spacer between the coding and RBS; therefore, the first few bases of the crRNA were changed to the reverse complement of the scar. Currently needs to be grown up in dam/- cells in order to cut with Xba. false Erin Zwack BBa_J31014_sequence 1 tctagttcacctcttggatttgggtattaaagaggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z