BBa_J32017 1 S*Tag S-Tag 2006-08-24T11:00:00Z 2015-08-31T04:08:46Z Novagen The S???Tag sequence is a novel fusion peptide tag for recombinant proteins that allows detection by a rapid, sensitive homogeneous assay or by colorimetric detection in Western blots. Proteins can also be rapidly purified from crude extracts using a one step affinity separation method. The system is based on the strong interaction between the 15aa S???Tag and 103aa S-protein. false false _50_ 0 495 50 It's complicated true . false Austen Heinz annotation1898184 1 S-Tag range1898184 1 1 46 BBa_J32017_sequence 1 aaaagaaaccgctgctgctaaattcgaacgccagcacatggacagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z