BBa_J331011 1 BBa_J331011 Water Purification from Lead 2016-12-03T12:00:00Z 2016-12-03T03:34:21Z Anderson promoter comes from part BBa_J23119. The RBS comes from part BBa_0030. CBP4 is naturally found in Nicotina tabacum, but it also comes from part BBa_J331007. Terminator comes from part BBa_B0014. T7 promoter comes from part BBa_I719005. GST is naturally found in S. japonicum, but it also comes from part BBa_T2025. CRS5 is a metallothionein found in S. serevisiae, but also comes from part BBa_ J331009. The linking sequence that will link CRS5 and GST comes from part BBa_J331010. This main purpose of this composite is to purify water from lead, so that it is cleaner for its use. This gene can be inserted into E.coli so that the bacteria can be placed in a tank filled with contaminated water and purify the water from lead. false false _1979_ 24251 24251 9 false None false Gilles Yvan Buck component2531703 1 BBa_B0030 component2531708 1 BBa_J331009 component2531690 1 BBa_J331007 component2531701 1 BBa_I719005 component2531688 1 BBa_B0030 component2531692 1 BBa_B0030 component2531686 1 BBa_J23119 component2531706 1 BBa_T2025 component2531700 1 BBa_B0014 component2531707 1 BBa_J331010 component2531710 1 BBa_B0030 component2531718 1 BBa_B0014 annotation2531718 1 BBa_B0014 range2531718 1 1710 1804 annotation2531710 1 BBa_B0030 range2531710 1 1687 1701 annotation2531703 1 BBa_B0030 range2531703 1 743 757 annotation2531706 1 BBa_T2025 range2531706 1 766 1422 annotation2531708 1 BBa_J331009 range2531708 1 1469 1678 annotation2531686 1 BBa_J23119 range2531686 1 1 35 annotation2531688 1 BBa_B0030 range2531688 1 44 58 annotation2531707 1 BBa_J331010 range2531707 1 1431 1462 annotation2531690 1 BBa_J331007 range2531690 1 65 577 annotation2531700 1 BBa_B0014 range2531700 1 609 703 annotation2531701 1 BBa_I719005 range2531701 1 712 734 annotation2531692 1 BBa_B0030 range2531692 1 586 600 BBa_T2025 1 BBa_T2025 Glutathione S-transferase internal domain 2009-09-16T11:00:00Z 2015-05-08T01:14:52Z This is a synthetic sequence. This is a GST internal domain designed to be between protein domains. GST domains are a type of affinity domain that can be used to purify and/or measure the quantity of proteins. false false _41_ 0 126 162 Not in stock false Rare codons in common model organisms were avoided along with restriction sites used in various assembly standards. false Reshma Shetty annotation2021346 1 GST range2021346 1 1 657 BBa_J331007 1 BBa_J331007 CBP4 2016-12-03T12:00:00Z 2016-12-03T10:23:32Z It comes from a genomic sequence. http://www.yeastgenome.org/locus/S000003406/sequence Mitochondrial protein required for gathering of cytochrome bc1 complex; interfaces with the Cbp3p-Cbp6p complex and recently integrated cytochrome b (Cobp) to advance get together of Cobp into the cytochrome bc1 complex. It was used by the 2014 Cornell Project as a part to remove lead from water. false false _1979_ 24251 24251 9 false None false Gilles Yvan Buck BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_J331010 1 BBa_J331010 Linking Sequence for Metallothionein (CRS5) and Glutathione S-Transferase (GST) 2016-12-03T12:00:00Z 2016-12-03T02:29:14Z It comes from a genomic sequence. This is a linking sequence used to link two coding regions (CRS5 and GST) without any RBS. These two are used as part of the process of removing lead (Pb) from water. false false _1979_ 24251 24251 9 false None false Gilles Yvan Buck BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939311 1 BBa_B0011 component939303 1 BBa_B0012 annotation939311 1 BBa_B0011 range939311 1 50 95 annotation939303 1 BBa_B0012 range939303 1 1 41 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_J331009 1 BBa_J331009 CSR5 (Metallothionein) 2016-12-03T12:00:00Z 2016-12-03T11:21:39Z Metallothionein. Genomic Sequence This coding region codes for the removal of heavy metals and the purification of substances. It can be used for the removal of lead, mercury, nickel, and others when combined with other biobricks to create a composite part. It was used by Cornell in 2014 to purify water from heavy metals. false false _1979_ 24251 24251 9 false None false Gilles Yvan Buck BBa_T2025_sequence 1 tccccgattctgggttattggaaaatcaagggtcttgtccagccgacccgccttctcctggagtatcttgaggaaaaatatgaggaacacctttacgaacgtgacgagggcgataaatggcgtaacaaaaagttcgagcttggcctcgaatttccgaatcttccgtactacattgacggcgacgtcaaactgacccagagcatggcgattatccgttacatcgcggataaacataacatgctcggcggttgtccgaaagagcgcgccgaaatttccatgcttgaaggtgccgtcctggatattcgttacggtgtgtcccgtattgcctacagcaaagactttgaaacccttaaagtggattttctctcgaaacttccggaaatgcttaaaatgttcgaagatcgtctgtgtcacaagacctacctcaacggcgaccatgtgacccacccggacttcatgctttatgacgcgcttgacgtggtgctctacatggacccgatgtgcctggacgcgttcccgaaacttgtgtgctttaaaaagcgcattgaagcgatcccgcagatcgacaagtaccttaagtccagcaagtatatcgcgtggccgcttcagggttggcaagccaccttcggtggcggtgatcacccgccgaaatccgac BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_J331009_sequence 1 atgactgtaaaaatatgtgactgttaaggcgaatgttgtaaggactcttgtcattgtgggagcacctgccttccaagctgttctggcggtgaaaagtgcaaatgtgatcacagcaccggaagccctcaatgtaagagttgtggtgaaaaatgcaaatgcgaaaccacgtgcacttgtgaaaagagtaaatgcaattgtgaaaaatgttag BBa_B0030_sequence 1 attaaagaggagaaa BBa_J331007_sequence 1 atgcagtgcgcgataactcctagagaggcagtaatagcaaaacaaagacagtataagcattatttgggtatggaaagaccattgtgggtacgttggttgaaagtctatgcaattggtggcgctattattggaagcgggtttctgcttttcaagtacacaacgccaacagatcaacagttaatcagccagctttccccagaattacgtttacaatatgagagggagaaaaaactacgtcagtcggagcagcaggctttgatgaaaattgttaaggaaacttctcaaagtgacgatccaatttggaagacgggcccccttcaatcaccttgggaaaggaacggtgataacgttcaaagcagagatcactttgctaaggtgagggcggaggaggtgcaaaaagaagagttggctaggatcagaaatgaactgtctcagctaagatctgaaacggaggagaaaacaaaggaaatagtccaggataagcaggttaaaagctggtggcgcttctggtag BBa_J331011_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagattaaagaggagaaatactagatgcagtgcgcgataactcctagagaggcagtaatagcaaaacaaagacagtataagcattatttgggtatggaaagaccattgtgggtacgttggttgaaagtctatgcaattggtggcgctattattggaagcgggtttctgcttttcaagtacacaacgccaacagatcaacagttaatcagccagctttccccagaattacgtttacaatatgagagggagaaaaaactacgtcagtcggagcagcaggctttgatgaaaattgttaaggaaacttctcaaagtgacgatccaatttggaagacgggcccccttcaatcaccttgggaaaggaacggtgataacgttcaaagcagagatcactttgctaaggtgagggcggaggaggtgcaaaaagaagagttggctaggatcagaaatgaactgtctcagctaagatctgaaacggaggagaaaacaaaggaaatagtccaggataagcaggttaaaagctggtggcgcttctggtagtactagagattaaagaggagaaatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattttactagagtaatacgactcactatagggagatactagagattaaagaggagaaatactagagtccccgattctgggttattggaaaatcaagggtcttgtccagccgacccgccttctcctggagtatcttgaggaaaaatatgaggaacacctttacgaacgtgacgagggcgataaatggcgtaacaaaaagttcgagcttggcctcgaatttccgaatcttccgtactacattgacggcgacgtcaaactgacccagagcatggcgattatccgttacatcgcggataaacataacatgctcggcggttgtccgaaagagcgcgccgaaatttccatgcttgaaggtgccgtcctggatattcgttacggtgtgtcccgtattgcctacagcaaagactttgaaacccttaaagtggattttctctcgaaacttccggaaatgcttaaaatgttcgaagatcgtctgtgtcacaagacctacctcaacggcgaccatgtgacccacccggacttcatgctttatgacgcgcttgacgtggtgctctacatggacccgatgtgcctggacgcgttcccgaaacttgtgtgctttaaaaagcgcattgaagcgatcccgcagatcgacaagtaccttaagtccagcaagtatatcgcgtggccgcttcagggttggcaagccaccttcggtggcggtgatcacccgccgaaatccgactactagagatcggatctggttccgcgtggatccattcatatactagatgactgtaaaaatatgtgactgttaaggcgaatgttgtaaggactcttgtcattgtgggagcacctgccttccaagctgttctggcggtgaaaagtgcaaatgtgatcacagcaccggaagccctcaatgtaagagttgtggtgaaaaatgcaaatgcgaaaccacgtgcacttgtgaaaagagtaaatgcaattgtgaaaaatgttagtactagagattaaagaggagaaatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc BBa_J331010_sequence 1 atcggatctggttccgcgtggatccattcata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z