BBa_J33204 1 BBa_J33204 xylE reporter gene with rbs 2006-10-16T11:00:00Z 2015-08-31T04:08:46Z The template DNA was kindly supplied by Dr. Peter Williams of the University of Wales, Bangor. The primer design was based on Genbank sequence M64747 (GI:151718). The sequence reported here was confirmed by sequencing the Biobrick construct. Released HQ 2013 This part includes the xylE gene from the Pseudomonas putida TOL (naphthalene and xylene degradadative plasmid) pWW0. This gene encodes the enzyme catechol-2,3-dioxygenase (metapyrocatechase), which converts catechol to the bright yellow product 2-hydroxy-cis,cis-muconic semialdehyde. This is a useful reporter gene; colonies or broths expressing active XylE, in the presence of oxygen, will rapidly convert catechol, a cheap colourless substrate, to a bright yellow compound with an absorbance maximum around 377 nm. The part includes the native ribosome binding site, so simply needs to be added after a suitable promoter to act as a reporter. I have previously used this gene to generate whole cell biosensors for various heavy metals. Note that, unlike Xgal etc., catechol in solution is prone to spontaneous oxidation resulting in brown melanin-like polymeric products, so is not stable enough to incorporate into plates or growth media; it should be dripped onto colonies (I use 10 mM catechol in water for this) or added to liquid cultures at a final concentration of about 0.5 mM prior to assay. Note also that there is a SacI site at the very start of the part, when the prefix is included, so this can be used as a replacement vector to introduce PCR products with SacI-SpeI ends into pSB1A2 giving them full Biobrick prefixes and suffixes (but don't forget the G base before the SpeI site). This results in shorter non-complementary tails on PCR primers than using a full prefix or suffix. You can test for colonies that have lost xylE using catechol as described above. false false _63_ 0 837 63 In stock true Note that this sequence includes the native ribsomome binding site. Also, when the prefix is included, there is a SacI site at the start, which allows this part to be used as a vector for insertion of PCR products with SacI-SpeI ends into pSB1A2, replacing xylE, giving the full Biobrick prefixes and suffixes (but don't forget the G base before the SpeI site). This results in shorter non-complementary tails on PCR primers than using a full prefix or suffix. You can test for colonies that have lost xylE using catechol as described above. true Chris French annotation1903406 1 rbs range1903406 1 14 19 annotation1903407 1 cds range1903407 1 27 950 BBa_J33204_sequence 1 ctcatgaactatgaagaggtgacgtcatgaacaaaggtgtaatgcgaccgggccatgtgcagctgcgtgtactggacatgagcaaggccctggaacactacgtcgagttgctgggcctgatcgagatggaccgtgacgaccagggccgtgtctatctgaaggcttggaccgaagtggataagttttccctggtgctacgcgaggctgacgagccgggcatggattttatgggtttcaaggttgtggatgaggatgctctccggcaactggagcgggatctgatggcatatggctgtgccgttgagcagctacccgcaggtgaactgaacagttgtggccggcgcgtgcgcttccaggccccctccgggcatcacttcgagttgtatgcagacaaggaatatactggaaagtggggtttgaatgacgtcaatcccgaggcatggccgcgcgatctgaaaggtatggcggctgtgcgtttcgaccacgccctcatgtatggcgacgaattgccggcgacctatgacctgttcaccaaggtgctcggtttctatctggccgaacaggtgctggacgaaaatggcacgcgcgtcgcccagtttctcagtctgtcgaccaaggcccacgacgtggccttcattcaccatccggaaaaaggccgcctccatcatgtgtccttccacctcgaaacctgggaagacttgcttcgcgccgccgacctgatctccatgaccgacacatctatcgatatcggcccaacccgccacggcctcactcacggcaagaccatctacttcttcgacccgtccggtaaccgcaacgaagtgttctgcgggggagattacaactacccggaccacaaaccggtgacctggaccaccgaccagctgggcaaggcgatcttttaccacgaccgcattctcaacgaacgattcatgaccgtgctgacctgatggtccgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z