BBa_I14032 1 P(Lac) IQ promoter P(Lac) IQ 2004-08-03T11:00:00Z 2015-08-31T04:07:37Z Plasmid pMAL-p2X Released HQ 2013 Constitutive Promoter, High Transcription false true _4_ 0 171 7 In stock false true Vikram Vijayan, Allen Hsu, Lawrence Fomundam annotation1028342 1 P(Lac) IQ range1028342 1 1 37 annotation1028344 1 -10 range1028344 1 26 31 annotation1028343 1 -35 range1028343 1 3 8 BBa_J34901 1 BBa_J34901 composite part 1 2006-07-11T11:00:00Z 2015-08-31T04:08:47Z genomic source Released HQ 2013 GFP composite part 1 true false _62_ 0 1092 62 Discontinued false design went smooth false Robert Schuetz annotation1884741 1 BBa_I14032 range1884741 1 1 37 annotation1884740 1 -10 range1884740 1 26 31 annotation1884739 1 -35 range1884739 1 3 8 annotation1884738 1 P(Lac) IQ range1884738 1 1 37 BBa_J34901_sequence 1 tggtgcaaaacctttcgcggtatggcatgatagcgcc BBa_I14032_sequence 1 tggtgcaaaacctttcgcggtatggcatgatagcgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z