BBa_J35120 1 B-Z DNA sw B-Z DNA switcher 2006-10-23T11:00:00Z 2015-08-31T04:08:47Z artificial sequence This DNA will be used as a part of DNA-origami device. The mechanical movement will be performed by B???Z DNA transition in the presence/absence of Co(NH3)6Cl3. false false _ 0 807 64 Not in stock false Mao C, Sun W, Shen Z, Seeman NC. A nanomechanical device based on the B-Z transition of DNA. Nature. 1999 Jan 14;397(6715):144-6. false Andrey Kuznetsov BBa_J35120_sequence 1 tggacactaagctattcatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z