BBa_J42051 1 BBa_J42051 fucK FB recomb. plasmid 2006-10-31T12:00:00Z 2015-08-31T04:08:48Z annealed oligos from Invitrogen Same as Bba_J42050 with the addition of the last 90 base pairs of the fucK gene between XhoI and HindIII false false _81_ 0 1129 81 Not in stock false none false Steve Selinsky BBa_J42051_sequence 1 gaattcatgttatccggctatattgcaggagcgattatgaaacaagaagttatcctggtactcgactgtggcgcgaccaatgtcagggccatcgcggagctcggggcggccgcgggcatatggggatcgatgggggatccggggtcgacgggctcgagaacagcccggaagaagcccgcgcacagattcattatcagtaccgttatttctacccgcaaactgaacctgaatttatagaggaagtgtgaaagctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z