BBa_J45000 1 BBa_J45000 Smell Enzyme 2006-06-06T11:00:00Z 2015-08-31T04:08:49Z Pichersky?? This enzyme salicylic acid to something smells cool true false _84_ 0 135 84 Discontinued false I hate this sort of restriction false Bartholomew Canton annotation1880473 1 Start Codon range1880473 1 1 3 BBa_J45000_sequence 1 atgctgcagtgataataatgctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z