BBa_J45993 1 p(osmY) Minimal stationary phase osmY promoter 2006-07-10T11:00:00Z 2015-08-31T04:08:50Z This part was PCRed out of E. coli's genome. osmY's promoter is active in stationary phase and under high osmotic pressure conditions. false false _84_ 0 642 84 Not in stock true Truncated Forward Primer: 5'- GTT TCT TCG AAT TCG CGG CCG CTT CTA GGCT TAT GTT TTC GCT GAT ATC - 3' Total Length: 49 bp Annealing Length: 21 bp GC Content: 38.1% Melting Temperature: 49.5 degrees C hairpin deltaG: -2.66 kcal/mol self dimer deltaG: -99.97 kcal/mol Reverse Primer: 5'-GTT TCT TCC TGC AGC GGC CGC TAC TAG TAT TGT TAA ATA TAG ATC ACA ATT TTG- 3' Total Length: 54 bp Annealing Length: 25 bp GC Content: 20.0% Melting Temperature: 46.4 degrees C hairpin deltaG: -2.86 kcal/mol self dimer deltaG: -99.44 kcal/mol heterodimer deltaG with Conserved Forward Primer: -99.97 kcal/mol false Stephen Payne annotation1883648 1 -35 range1883648 1 22 27 annotation1883647 1 -10 range1883647 1 46 51 BBa_J45170 1 SWOG Stationary-phase-dependent wintergreen odor generator 2006-08-09T11:00:00Z 2015-08-31T04:08:49Z Still in development as SPP is not confirmed to work. This is the wintergreen generating device hooked up to a stationary phase promoter with RBS B0032. false false _84_ 0 1147 84 It's complicated false Biobricks of osmY promoter and intermediate 45119. false MIT IGEM 2006 component1894801 1 BBa_J45993 component1894811 1 BBa_B0012 component1894803 1 BBa_B0032 component1894808 1 BBa_J45004 component1894809 1 BBa_B0010 annotation1894809 1 BBa_B0010 range1894809 1 1167 1246 annotation1894808 1 BBa_J45004 range1894808 1 85 1158 annotation1894811 1 BBa_B0012 range1894811 1 1255 1295 annotation1894801 1 BBa_J45993 range1894801 1 1 57 annotation1894803 1 BBa_B0032 range1894803 1 66 78 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 BBa_J45004 1 BSMT1 SAM:benzoic acid/salicylic acid carboxyl methyltransferase I; converts salicylic acid to methyl sali 2006-06-06T11:00:00Z 2015-08-31T04:08:49Z Species: Petunia x hybrida from Genbank; (also available: A. thaliana and N. suaveolens) Codes for BSMT enzyme to convert Benzoic acid/salicylic acid to methyl benzoate and methyl salicylate. This part is phBSMT1 from Petunia x hybrida. false false _84_ 0 974 84 It's complicated true Transport issues are being considered. true Boyuan Zhu annotation1880520 1 stop codon range1880520 1 1072 1074 annotation1880519 1 start codon range1880519 1 1 3 annotation1880517 1 BMST1 range1880517 1 1 1074 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0032_sequence 1 tcacacaggaaag BBa_J45170_sequence 1 gcttatgttttcgctgatatcccgagcggtttcaaaattgtgatctatatttaacaatactagagtcacacaggaaagtactagatggaagttgttgaagttcttcacatgaatggaggaaatggagacagtagctatgcaaacaattctttggttcagcaaaaggtgattctcatgacaaagccaataactgagcaagccatgattgatctctacagcagcctctttccagaaaccttatgcattgcagatttgggttgttctttgggagctaacactttcttggtggtctcacagcttgttaaaatagtagaaaaagaacgaaaaaagcatggttttaagtctccagagttttattttcacttcaatgatcttcctggcaatgattttaatacactttttcagtcactgggggcatttcaagaagatttgagaaagcatataggggaaagctttggtccatgttttttcagtggagtgcctggttcattttatactagacttttcccttccaaaagtttacattttgtttactcctcctacagtctcatgtggctatctcaggtgcctaatgggattgaaaataacaagggaaacatttacatggcaagaacaagccctctaagtgttattaaagcatactacaagcaatatgaaatagatttttcaaattttctcaagtaccgttcagaggaattgatgaaaggtggaaagatggtgttaacactcctaggtagagaaagtgaggatcctactagcaaagaatgctgttacatttgggagcttctagccatggccctcaataagttggttgaagagggattgataaaagaagagaaagtagatgcattcaatattcctcaatacacaccatcaccagcagaagtaaagtacatagttgagaaggaaggatcattcaccattaatcgcttggaaacatcaagagttcattggaatgcttctaataatgagaagaatggtggttacaatgtgtcaaggtgcatgagagctgtggctgagcctttgcttgtcagccactttgacaaggaattgatggatttagtgttccacaagtacgaagagattgtttctgattgcatgtccaaagagaatactgagtttataaatgtcatcatctccttgaccaaaataaattaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J45993_sequence 1 gcttatgttttcgctgatatcccgagcggtttcaaaattgtgatctatatttaacaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J45004_sequence 1 atggaagttgttgaagttcttcacatgaatggaggaaatggagacagtagctatgcaaacaattctttggttcagcaaaaggtgattctcatgacaaagccaataactgagcaagccatgattgatctctacagcagcctctttccagaaaccttatgcattgcagatttgggttgttctttgggagctaacactttcttggtggtctcacagcttgttaaaatagtagaaaaagaacgaaaaaagcatggttttaagtctccagagttttattttcacttcaatgatcttcctggcaatgattttaatacactttttcagtcactgggggcatttcaagaagatttgagaaagcatataggggaaagctttggtccatgttttttcagtggagtgcctggttcattttatactagacttttcccttccaaaagtttacattttgtttactcctcctacagtctcatgtggctatctcaggtgcctaatgggattgaaaataacaagggaaacatttacatggcaagaacaagccctctaagtgttattaaagcatactacaagcaatatgaaatagatttttcaaattttctcaagtaccgttcagaggaattgatgaaaggtggaaagatggtgttaacactcctaggtagagaaagtgaggatcctactagcaaagaatgctgttacatttgggagcttctagccatggccctcaataagttggttgaagagggattgataaaagaagagaaagtagatgcattcaatattcctcaatacacaccatcaccagcagaagtaaagtacatagttgagaaggaaggatcattcaccattaatcgcttggaaacatcaagagttcattggaatgcttctaataatgagaagaatggtggttacaatgtgtcaaggtgcatgagagctgtggctgagcctttgcttgtcagccactttgacaaggaattgatggatttagtgttccacaagtacgaagagattgtttctgattgcatgtccaaagagaatactgagtttataaatgtcatcatctccttgaccaaaataaattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z