BBa_J45993 1 p(osmY) Minimal stationary phase osmY promoter 2006-07-10T11:00:00Z 2015-08-31T04:08:50Z This part was PCRed out of E. coli's genome. osmY's promoter is active in stationary phase and under high osmotic pressure conditions. false false _84_ 0 642 84 Not in stock true Truncated Forward Primer: 5'- GTT TCT TCG AAT TCG CGG CCG CTT CTA GGCT TAT GTT TTC GCT GAT ATC - 3' Total Length: 49 bp Annealing Length: 21 bp GC Content: 38.1% Melting Temperature: 49.5 degrees C hairpin deltaG: -2.66 kcal/mol self dimer deltaG: -99.97 kcal/mol Reverse Primer: 5'-GTT TCT TCC TGC AGC GGC CGC TAC TAG TAT TGT TAA ATA TAG ATC ACA ATT TTG- 3' Total Length: 54 bp Annealing Length: 25 bp GC Content: 20.0% Melting Temperature: 46.4 degrees C hairpin deltaG: -2.86 kcal/mol self dimer deltaG: -99.44 kcal/mol heterodimer deltaG with Conserved Forward Primer: -99.97 kcal/mol false Stephen Payne annotation1883648 1 -35 range1883648 1 22 27 annotation1883647 1 -10 range1883647 1 46 51 BBa_J45993_sequence 1 gcttatgttttcgctgatatcccgagcggtttcaaaattgtgatctatatttaacaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z