BBa_J4906 1 BBa_J4906 WrooHEAD2 (Wayne Rooney's Head dependent promoter) 2006-06-14T11:00:00Z 2015-08-31T03:54:03Z GlenShire, England Wayne Rooney's head dependent promoter is activated by proximity of Wayne Rooney's head. Is inhibited by broken metatarsal protein right before the World Cup. false false _74_ 0 712 74 Not in stock false Gene can be repressed by sheer ugliness and lumpiness of Wayne Rooney's head. false Bashir Geer BBa_J4906_sequence 1 aatgccgagccgagagagagagacggcgatagtgtttatcgatgcatgcgatgcgtagcatcgcgatgtgactgtgactgcatgctagagcatgctactgatcgctacgagcgagctgactg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z