BBa_J54200 1 BBa_J54200 lacq_Promoter 2006-10-14T11:00:00Z 2015-08-31T03:48:12Z DNA synthesis Promoter that express always. false false _76_ 0 762 76 Not in stock false As promoter false Yusaku Nakashima annotation1903215 1 lacq Promoter range1903215 1 14 48 annotation1903214 1 BamHI range1903214 1 7 13 BBa_J54200_sequence 1 ccgtgacggatcctggtgcaaaacctttcgcggtatggcatgatagcgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z