BBa_J54220 1 BBa_J54220 FadR_Binding_Site 2006-10-14T11:00:00Z 2015-08-31T03:48:12Z DNA synthesis FadR_Binding_Site false false _76_ 0 762 76 Not in stock false As Regulator false Yusaku Nakashima annotation1903244 1 BglII range1903244 1 22 28 annotation1903245 1 FadR range1903245 1 6 21 BBa_J54220_sequence 1 gatcatctggtacgaccagatagatctatgcata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z