BBa_J580002 1 BBa_J580002 -- No description -- 2006-07-12T11:00:00Z 2015-08-31T03:14:48Z catacatc This is a long description of the part, wow!!!!!. true false _83_ 0 1098 83 Discontinued false lnjkinjinjinhj false Caterina Mata Garcia annotation1885109 1 my mutation range1885109 1 1 3 BBa_J580002_sequence 1 catacatatccccgggggaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z