BBa_J62006 1 BBa_J62006 {SH3 ligand}{SH3 ligand} 2008-07-28T11:00:00Z 2015-08-31T01:56:26Z BBa_J62003 is the 5' part and BBa_J62002 is the 3' part assembled using BBb format to make a GGATCT scar. Sequence encoding two repeats of an N-terminal 5 total amino acid glycine/serine linker and a peptide ligand with a Kd=0.1uM affinity for murine Crk N-terminal SH3 domain. The two repeats are encoded by degenerate sequences "B" and "A." false false _96_ 0 929 96 Not in stock false N/A false John Dueber annotation1969232 1 BBa_J62002 range1969232 1 61 114 annotation1969231 1 BBa_J62003 range1969231 1 1 54 BBa_J62006_sequence 1 ggttcgggcagtggtagcgggcctccgccagccttacctccgaagcgtcgccgtggatctggcagcggttcggggagcggcccaccgcctgcgctgccgccaaaacgccgtcgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z