BBa_J63007 1 PKI NES PKI nuclear export sequence; yeast codon optimized 2006-10-10T11:00:00Z 2015-08-31T01:56:26Z from genomic DNA yeast codon optimized PKI nuclear export sequence false false _97_ 0 545 97 It's complicated false optimized codons for S. cerevisiae false Caroline Ajo-Franklin BBa_J63007_sequence 1 ttggctttgaaattggctggtttggatatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z