BBa_J64002 1 BBa_J64002 sicP Chaperone 2008-01-14T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA The sicP protein is from the Salmonella SPI-1 Type III secretion system and forms a dimer when expressed. The dimer interacts with the secretion signal of the SptP protein. The sicP acts as a chaperone keeping the N-Terminus unfolded and directs the SptP protein to the secretion system at the proper time. false false _98_ 0 2407 98 Not in stock false This part contains 2 PstI sites so it is incompatible with biobrick standard assembly false Dan Widmaier annotation1959592 1 sicP range1959592 1 1 393 BBa_J64002_sequence 1 atgcaagcacaccaggatattatcgctaatattggtgagaaattgggtttaccgctcacttttgacgacaacaatcagtgcttattattactcgatagcgatatttttacgtctattgaagctaaagatgatatctggttattgaacggtatgattataccgttatcgcctgtttgtggcgattctatctggcggcagattatggtgattaatggtgaactggctgcgaataatgaaggtacgttagcgtatattgatgccgcagagacgttgttgcttatacatgcaattaccgatctgacaaatacttaccatattatatcgcagcttgagtcatttgtgaatcagcaggaagcgctcaaaaacatactgcaggaatatgctaaagtatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z