BBa_J64005 1 3x FLAG 3x FLAG affinity tag 2008-01-15T12:00:00Z 2015-08-31T01:56:26Z Synthetic DNA from Oligonucleotide synthesis A 3 repeat FLAG (DYKDDDDK) antigen epitope tag used for marking proteins of interest. Proteins carrying this tag can be easily detected using commercial western blotting reagents. false false _98_ 0 2407 98 Not in stock false This sequence was designed as part of an oligonucleotide primer on each strand then annealed and ligated into the vector. false Dan Widmaier annotation1959595 1 3x FLAG Tag range1959595 1 1 72 annotation1960214 1 XbaI Restriction Site range1960214 1 76 81 annotation1959596 1 STOP Codon range1959596 1 73 75 BBa_J64005_sequence 1 gattataaagatgacgatgacaaggattataaagatgacgatgacaaggattataaagatgacgatgacaagtaatctaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z