BBa_J64014 1 BBa_J64014 sopA Secretion Signal 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This part encodes the secretion signal for the sopA protein in the Salmonella Type III Secretion System (T3S). This signal is sufficient to direct a fused protein to secrete through T3S and includes the necessary chaperone binding domain. The cognate chaperone for sopA is invB (BBa_J64009) and is required for secretion at high titer. false false _98_ 0 2407 98 Not in stock false This part was not designed with compliance to biobrick standard assembly in mind. false Dan Widmaier annotation1959613 1 sopA Secretion Signal range1959613 1 1 288 BBa_J64014_sequence 1 atgaagatatcatcaggcgcaattaatttttctactattcctaaccaggttaaaaaattaattacctctattcgtgaacatacgaaaaacgggctcacctcaaaaataaccagtgttaaaaacacgcatacatctttaaatgaaaaatttaaaacaggaaaggactcaccgattgagttcgcgttaccacaaaaaataaaagacttctttcagccgaaagataaaaacaccttaaacaaaacattgattactgttaaaaatattaaagatacaaataatgcaggcaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z