BBa_J64043 1 BBa_J64043 T1 terminator 2008-01-21T12:00:00Z 2015-05-08T01:08:16Z Commercial plasmid DNA This is the T1 terminator from the pPROTet 6xHN vector commercially available from Clontech. false false _98_ 0 2407 98 Not in stock false This sequence is not designed with biobrick standard assembly compatibility in mind. false Dan Widmaier annotation1960020 1 T1 Terminator range1960020 1 1 105 BBa_J64007 1 BBa_J64007 TEVr 2008-01-15T12:00:00Z 2015-08-31T01:56:26Z Synthetically created from oligonucleotide synthesis The Tobacco Etch Virus (TEV) protease cleavage recognition sequence. This DNA sequence encodes an amino acid sequence recognized by TEV protease (ENLYFQS) for efficient cleavage. The sequence is flanked by glycines on the ends to increase flexibility and accessibility to the protease. After proteolytic processing the C-terminal fragment retains only an S residue, however by the design of this part it will leave an SG dipeptide which becomes the new N-terminus of the mature polypeptide. false false _98_ 0 2407 98 Not in stock false This part was codon optimized for expression in E.Coli. false Dan Widmaier annotation1959599 1 Gly range1959599 1 25 27 annotation1959598 1 Gly range1959598 1 1 3 annotation1959597 1 TEV protease recognition sequence range1959597 1 4 24 BBa_J64005 1 3x FLAG 3x FLAG affinity tag 2008-01-15T12:00:00Z 2015-08-31T01:56:26Z Synthetic DNA from Oligonucleotide synthesis A 3 repeat FLAG (DYKDDDDK) antigen epitope tag used for marking proteins of interest. Proteins carrying this tag can be easily detected using commercial western blotting reagents. false false _98_ 0 2407 98 Not in stock false This sequence was designed as part of an oligonucleotide primer on each strand then annealed and ligated into the vector. false Dan Widmaier annotation1959596 1 STOP Codon range1959596 1 73 75 annotation1959595 1 3x FLAG Tag range1959595 1 1 72 annotation1960214 1 XbaI Restriction Site range1960214 1 76 81 BBa_J64032 1 BBa_J64032 pCASP SPI-1 Secretion Circuit 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z This is a composite part consisting of both natural and synthetic DNA components The pCASP circuit is a protein expression and secretion circuit. The system is currently only functional when expressed in Salmonella under SPI-1 expressing conditions. When SPI-1 is expressed the pCASP circuit will be activated for expression at the same time natural effectors would normally turn on and secrete. This circuit will express a protein of interest fused to the SptP167 secretion signal along with co-expression of the sicP chaperone. This combination is sufficient to direct the protein of interest to the export machinery and elicit secretion to the extracellular environment. In the initial configuration of this circuit the DH guanine exchange factor is used as a de-bugging secreted protein. Note: Some evidence exists of impassible substrates for the secretion machinery. Most of these proteins are highly thermodynamically stable domains that cannot be unfolded to transit through the secretion system. false false _98_ 0 2407 98 Not in stock false This device was not designed with biobrick standard assembly in mind and has several of the scar sequence sites throughout the circuit. false Dan Widmaier component1960222 1 BBa_J64022 component1960230 1 BBa_J64007 component1960226 1 BBa_J64008 component1960234 1 BBa_J64004 component1960238 1 BBa_J64005 component1960220 1 BBa_J64001 component1960240 1 BBa_J64043 annotation1960230 1 BBa_J64007 range1960230 1 1044 1070 annotation1960220 1 BBa_J64001 range1960220 1 1 143 annotation1960240 1 BBa_J64043 range1960240 1 1773 1877 annotation1960226 1 BBa_J64008 range1960226 1 164 1043 annotation1960238 1 BBa_J64005 range1960238 1 1692 1772 annotation1960234 1 BBa_J64004 range1960234 1 1071 1691 annotation1960222 1 BBa_J64022 range1960222 1 144 163 BBa_J64001 1 BBa_J64001 psicA from <I>Salmonella</I> 2008-01-14T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA The sicA promoter is a regulatory element in the Salmonella SPI-1 secretion system. It controls the expression of secreted effector proteins in the natural system and turns on late. Please reference Temme et al, 2008, JMB for exact dynamics of this promoter and associated feedback mechanisms. This promoter only functions in Salmonella strains containing SPI-1. false false _98_ 0 2407 98 Not in stock false This part can only be used in salmonella strains. false Dan Widmaier annotation1959631 1 +1 Transcriptional Start Site range1959631 1 106 106 annotation1959628 1 InvF:SicA Binding Box range1959628 1 54 65 annotation1959627 1 sicA Promoter range1959627 1 1 143 annotation1959630 1 -10 Hexamer range1959630 1 94 100 annotation1959629 1 -35 Hexamer range1959629 1 71 77 BBa_J64008 1 SicP-SptP SicP-SptP chaperone-secretion tag pair from Salmonella type III secretion system 2008-01-15T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This part is the natural implementation of the SicP chaperone (BBa_J64002) and SptP secretion signal (BBa_J64003) from the Salmonella Type III Secretion System (T3S, the Salmonella T3S coding region is referred to as Salmonella Pathogeneity Island 1 [SPI-1]). In the natural implementation the coding regions of SicP and SptP overlap out of frame. This part captures that configuration for use in creating secreted protein / chaperone pairs. false false _98_ 0 2407 98 Not in stock false This part is not compatible with biobrick standard assembly. false Dan Widmaier annotation1959600 1 sicP range1959600 1 1 393 annotation1959601 1 sptP167 range1959601 1 380 880 annotation1959602 1 sptP RBS range1959602 1 359 379 BBa_J64022 1 BBa_J64022 sicA RBS 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This is the natural RBS from the sicA chaperone (BBa_J6021) in the Salmonella Type III Secretion System. false false _98_ 0 2407 98 Not in stock false This part was not designed with standard biobrick assembly in mind. false Dan Widmaier annotation1959621 1 misc range1959621 1 1 20 BBa_J64004 1 BBa_J64004 DH domain constitutively active 2008-01-15T12:00:00Z 2015-08-31T01:56:26Z Human Genomic DNA library clone with 2 point mutations This protein coding frame is a Guanine Exchange Factor (GEF) domain from human eukaryotic with point mutations to make it constitutively active. This protein can be secreted at high titer via the Salmonella T3S using the Voigt Lab secretion circuit. false false _98_ 0 2407 98 Not in stock false This part contains 2 PstI sites and is incompatible with biobrick standard assembly false Dan Widmaier annotation1959594 1 DH Domain range1959594 1 7 612 annotation1960213 1 NotI Restriction Site range1960213 1 613 621 annotation1960212 1 HindIII Restriction Site range1960212 1 1 6 BBa_J64001_sequence 1 ccacaagaaaacgaggtacggcattgagccgcgtaaggcagtagcgatgtattcattgggcgttttttgaatgttcactaaccaccgtcggggtttaataactgcatcagataaacgcagtcgttaagttctacaaagtcggt BBa_J64004_sequence 1 aagcttgatatgttgaccccaactgaaagaaagcgacaaggatacatccacgagctcattgtcaccgaggagaactatgtgaatgacctgcagctggtcacagagatttttcaaaaacccctgatggagtctgagctgctgacagaaaaagaggttgctatgatttttgtgaactggaaggagctgattatgtgtaatatcaaactactaaaagcgctgagagtccgcaagaagatgtccggggagaagatgcctgtgaagatgattggagacatcctgagcgcacagctgccgcacatgcagccctacatccgcttctgcagccgccagctcaacggggctgccctgatccagcagaagacggacgaggccccagacttcaaggagttcgtcaaaagattggcaatggatcctcggtgtaaagggatgccactctctagttttatactgaagcctatgcaacgggtaacaagatacccactgatcattaaaaatatcctggaaaacacccctgaaaaccacccggaccacagccacttgaagcacgccctggagaaggcggaagagctctgttcccaggtgaacgaaggggtgcgggagaaggagaactctagcggccgc BBa_J64032_sequence 1 ccacaagaaaacgaggtacggcattgagccgcgtaaggcagtagcgatgtattcattgggcgttttttgaatgttcactaaccaccgtcggggtttaataactgcatcagataaacgcagtcgttaagttctacaaagtcggtacagataacaggagtaagtaatgcaagcacaccaggatattatcgctaatattggtgagaaattgggtttaccgctcacttttgacgacaacaatcagtgcttattattactcgatagcgatatttttacgtctattgaagctaaagatgatatctggttattgaacggtatgattataccgttatcgcctgtttgtggcgattctatctggcggcagattatggtgattaatggtgaactggctgcgaataatgaaggtacgttagcgtatattgatgccgcagagacgttgttgcttatacatgcaattaccgatctgacaaatacttaccatattatatcgcagcttgagtcatttgtgaatcagcaggaagcgctcaaaaacatactgcaggaatatgctaaagtatgaggagagaaaattgaataatttaacgttgtcttcgttttcaaaagttggtgtgtcgaatgatgcccgactttatattgctaaggaaaatactgataaggcatatgttgcgcctgaaaaattttcgtcaaaagtattaacctggcttggaaaaatgccgttatttaaaaacactgaagtggtgcaaaaacatacggaaaatatcagagtacaggaccaaaagattttacagacatttctccatgcactaacggaaaaatatggggaaacagcggttaatgacgcactgttaatgtcccgtataaatatgaacaaaccccttacccaacgtttagcagtgcagatcacggagtgtgtaaaagctgctgacgaagggtttataaaccttattaagagcaaggataatgttggtgtcaggaatgccgctttagtcataaaaggcggcgatacaaaagtggcagaaaaaaataacgatgttggagcagaaagtggagagaatttgtattttcagtcaggaaagcttgatatgttgaccccaactgaaagaaagcgacaaggatacatccacgagctcattgtcaccgaggagaactatgtgaatgacctgcagctggtcacagagatttttcaaaaacccctgatggagtctgagctgctgacagaaaaagaggttgctatgatttttgtgaactggaaggagctgattatgtgtaatatcaaactactaaaagcgctgagagtccgcaagaagatgtccggggagaagatgcctgtgaagatgattggagacatcctgagcgcacagctgccgcacatgcagccctacatccgcttctgcagccgccagctcaacggggctgccctgatccagcagaagacggacgaggccccagacttcaaggagttcgtcaaaagattggcaatggatcctcggtgtaaagggatgccactctctagttttatactgaagcctatgcaacgggtaacaagatacccactgatcattaaaaatatcctggaaaacacccctgaaaaccacccggaccacagccacttgaagcacgccctggagaaggcggaagagctctgttcccaggtgaacgaaggggtgcgggagaaggagaactctagcggccgcgattataaagatgacgatgacaaggattataaagatgacgatgacaaggattataaagatgacgatgacaagtaatctagaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgccctaga BBa_J64043_sequence 1 ggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgccctaga BBa_J64008_sequence 1 atgcaagcacaccaggatattatcgctaatattggtgagaaattgggtttaccgctcacttttgacgacaacaatcagtgcttattattactcgatagcgatatttttacgtctattgaagctaaagatgatatctggttattgaacggtatgattataccgttatcgcctgtttgtggcgattctatctggcggcagattatggtgattaatggtgaactggctgcgaataatgaaggtacgttagcgtatattgatgccgcagagacgttgttgcttatacatgcaattaccgatctgacaaatacttaccatattatatcgcagcttgagtcatttgtgaatcagcaggaagcgctcaaaaacatactgcaggaatatgctaaagtatgaggagagaaaattgaataatttaacgttgtcttcgttttcaaaagttggtgtgtcgaatgatgcccgactttatattgctaaggaaaatactgataaggcatatgttgcgcctgaaaaattttcgtcaaaagtattaacctggcttggaaaaatgccgttatttaaaaacactgaagtggtgcaaaaacatacggaaaatatcagagtacaggaccaaaagattttacagacatttctccatgcactaacggaaaaatatggggaaacagcggttaatgacgcactgttaatgtcccgtataaatatgaacaaaccccttacccaacgtttagcagtgcagatcacggagtgtgtaaaagctgctgacgaagggtttataaaccttattaagagcaaggataatgttggtgtcaggaatgccgctttagtcataaaaggcggcgatacaaaagtggcagaaaaaaataacgatgttggagcagaaagt BBa_J64005_sequence 1 gattataaagatgacgatgacaaggattataaagatgacgatgacaaggattataaagatgacgatgacaagtaatctaga BBa_J64022_sequence 1 acagataacaggagtaagta BBa_J64007_sequence 1 ggagagaatttgtattttcagtcagga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z