BBa_J64067 1 BBa_J64067 LuxR+3OC6HSL independent R0065 2007-12-12T12:00:00Z 2015-05-08T01:08:17Z modified from R0065 The -35 box of R0065 has been modified to promote constitutive (LuxR+3OC6HSL-independent) gene expression. An extended -10 sequence has also been added to increase absolute transcription. The promoter still contains the operators OR1 and OR2 such that it retains its sensitivity to CI. false false _98_ 0 88 98 Not in stock false see above false Jeffrey J Tabor annotation1959023 1 OR2 range1959023 1 58 75 annotation1959022 1 +1 range1959022 1 59 59 annotation1959024 1 OR1 range1959024 1 82 98 annotation1959021 1 lux box range1959021 1 6 26 annotation1959019 1 extended -10 range1959019 1 43 46 annotation1959018 1 -35 range1959018 1 25 30 annotation1959020 1 -10 range1959020 1 48 53 BBa_J64067_sequence 1 taagcacctgtaggatcgtacaggttgacaacaagaaaatggtgtgttatagtcgaataacaccgtgcgtgttgactattttacctctggcggtgata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z