BBa_J70025 1 BBa_J70025 Promoter for tetM gene, from pBOT1 plasmid, pAMbeta1 2008-10-19T11:00:00Z 2015-05-08T01:08:20Z pBOT1 plasmid PCR. pBOT1 from J. Renaudin. Original sequence is part of pAMbeta1 tetracycline resistance plasmid. Upstream promoter for tetM gene; contains a short peptide leader, regulatory sequences which are poorly understood. Use in combination with J70024. false false _41_48_1_ 0 6 48 Not in stock true Alignment of the promoter with the coding region, preservation of the RBS sites. false Tom Knight annotation1999382 1 RBS range1999382 1 339 345 annotation1999387 1 rbs range1999387 1 237 240 annotation1999388 1 -10 range1999388 1 68 73 annotation1999385 1 stem_loop range1999385 1 254 281 annotation1999383 1 term range1999383 1 319 330 annotation1999384 1 stem_loop range1999384 1 273 320 annotation1999390 1 +1 range1999390 1 80 80 annotation1999386 1 stem_loop range1999386 1 242 272 annotation1999391 1 leader peptide range1999391 1 250 336 annotation1999389 1 -35 range1999389 1 45 50 BBa_J70025_sequence 1 ggccagtctacatgtactctttttgataaaaaattggagattcctttacaaatatgctcttacgtgctattatttaagtgactatttaaaaggagttaataaatatgcggcaaggtattcttaaataaactgtcaatttgatagcgggaacaaataattagatgtccttttttaggagggcttagttttttgtacccagtttaagaatacctttatcatgtgattctaaagtatccagagaatatctgtatgctttgtatacctatggttatgcataaaaatcccagtgataaaagtatttatcactgggatttttatgcccttttgggtttttgaatggaggaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z