BBa_J70494 1 BBa_J70494 gfp RBS, {0,5;15,10} family member - level 100000 (master sequence) 2009-08-31T11:00:00Z 2015-05-08T01:08:23Z designed These oligo parts can be used for converting any pathway of the form (Promoter X)-(Bioscaffold part {0,5;15,10})-GFP to (Promoter X)-(RBS level Y)-GFP. Note that this removes the scar on the right side of the RBS, except when traditional BioBrick derived RBSes have been used (for example BBa_B0034.) (In this case it was not necessary to remove gtg starts since they were not present near the start of gfp.) Form of insert: {promoter} ta ctaga ^ g {rbs master sequence} atg c gtaaa ^ {rest of GFP (E0040)} {promoter} at ^ gatct c {rbs master sequence} tac g^ cattt {rest of GFP (E0040)} Forward oligo: g {rbs master sequence} atg c gtaaa Reverse oligo: Reverse complement of (ctagag {rbs master sequence} atg c) false false _41_ 0 1201 41 Not in stock false none false Julie Norville BBa_J70494_sequence 1 tagagccgttaaagaagctaggaggccgaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z