BBa_J70586 1 BBa_J70586 Mutant Glns promoter (sequence only not shifted relative to scar) 2010-06-12T11:00:00Z 2015-05-08T01:08:24Z Probably from this reference: Efficient incorporation of unnatural amino acids into proteins in Escherichia coli Youngha Ryu & Peter G Schultz It may be better to introduce this with a BIoScaffold part in order to not have to deal with scars. This is a mutant glnS Compare to part GlnRS promoter This part promotes the transcription of TyrRS(aminoacyl tRNA synthetase). >BBa_K088007 This is a mutant glnS promoter for pEVOL. false false _41_ 0 1201 41 Not in stock false this does not take into account the scar false Julie Norville BBa_J70586_sequence 1 ccgagctcccgggtcatcaatcatccccataatccttgttagattatcaattttaaaaaactaacagttgtcagcctgtcccgcttataatatcatacgccgttatacgttgtttacgctttgaggaatcccatatggac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z