BBa_J72158 1 BBa_J72158 minimal ColE2 origin of replication 2012-09-16T11:00:00Z 2015-05-08T01:08:28Z n/a The reported minimal origin of replication from the ColE2-P9 plasmid. Does not appear to confer stable replication in our hands. false false _171_ 0 947 95 Not in stock false n/a false Josh Kittleson BBa_J72158_sequence 1 aaaatgagaccagataagccttatcagataacagcgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z