BBa_J85600 1 BBa_J85600 attB1 recombination site 2011-09-05T11:00:00Z 2015-05-08T01:08:30Z lambda phage attB1 recombination site Used for creating mammoblock (RFC65) composite promoter-gene pairs using recombination-based cloning. false false _406_ 0 106 406 Not in stock false None false Ron Weiss annotation2125966 1 attB1 range2125966 1 2 22 BBa_J85600_sequence 1 ccaagtttgtacaaaaaagcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z