BBa_K079018 1 BBa_K079018 Lac 1 - operator library member 2008-10-23T11:00:00Z 2015-05-08T01:08:33Z Geneart synthesis service. the... false false _185_ 0 3530 9 Not in stock true The Lac Operator 1 sequence was flanked by the standard Prefix and Suffix. false Francesca Ceroni BBa_K079018_sequence 1 aattgtgagcggataacaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z