BBa_K079019 1 BBa_K079019 Lac 2 - operator library member 2008-10-23T11:00:00Z 2015-05-08T01:08:33Z Geneart synthesis service the false false _185_ 0 3530 9 Not in stock true The BBa_K079019 part was designed as the Lac operator 2 sequence flanked by the standard Prefix and Suffix. false Francesca Ceroni BBa_K079019_sequence 1 aaatgtgagcgagtaacaacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z