BBa_B1006 1 BBa_B1006 Terminator (artificial, large, %T~>90) 2006-08-30T11:00:00Z 2015-08-31T04:07:21Z modified E. coli thr terminator, replaced all A-T pairs in stem with C-G pairs Released HQ 2013 Artificial terminator, estimated %T~>90% *8bp stem, 6nt loop *Bidirectional, estimated reverse %T~>90% false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 9 residues. true Haiyao Huang annotation1898431 1 PolyA range1898431 1 1 9 annotation1898430 1 PolyA range1898430 1 32 39 annotation1898429 1 modified thr terminator range1898429 1 10 31 annotation1898428 1 B1006 range1898428 1 1 39 BBa_C0078 1 lasI autoinducer synthetase for PAI from Pseudomonas aeruginosa 2004-01-27T12:00:00Z 2015-08-31T04:07:24Z www.ncbi.nlm.nih.gov Released HQ 2013 coding region for lasI protein, which produces the chemical signal AI-1 false false _1_ 0 24 7 In stock false true Chris Walsh (Fighting Darwins) annotation2214003 1 Help:Barcodes range2214003 1 643 667 annotation305970 1 LasI range305970 1 1 603 annotation306608 1 LVA range306608 1 604 636 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_C0061 1 luxI autoinducer synthetase for AHL 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <em>V. fischeri</em> <genbank>AF170104</genbank> Released HQ 2013 Synthesizes 3OC<sub>6</sub>HSL, which binds to LuxR.</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the Lux repressor, LuxR. Two molecules of LuxR protein form a complex with two molecules the signalling compound HSL. This complex binds to a palindromic site on the promoter, increasing the rate of transcription.</p> false false _1_ 0 24 7 In stock false <P> <P>An LVA tail (sequence: AANDENYALVA) was added to increase protein degradation. . <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation1761 1 luxI range1761 1 1 579 annotation7038 1 BBa_C0061 range7038 1 1 618 annotation1760 1 LVA range1760 1 580 611 annotation2213985 1 Help:Barcodes range2213985 1 619 643 BBa_K081003 1 BBa_K081003 Demux INPUT 2008-10-18T11:00:00Z 2015-05-08T01:08:34Z RBS: cI: lasR: T: Plambda: luxR: Released HQ 2013 This composite part is the union of: *a PoPS in -> cI, lasR out device and *a Plambda-regulated luxR protein generator. It is a module of the following genetic multiplexer (mux): {|align="center" |[[Image:Pv_mux_final.png|500px]] |- |[[Image:pv_muxregistry_interactions.png|500px]] |} where: *PA, PS and PB are three promoters that can be ACTIVATED by the three generic elements A, S and B respectively; *GOI is the ''gene of interest'' that is the output of the system. In particular, '''K081003 is the Selector'''. People who want to use the genetic mux have to assemble: *K081000 under the desired regulation for Channel 0 (for example the generic promoter PA); *K081001 under the desired regulation for Channel 1 (for example the generic promoter PB); *K081002 under the desired regulation for Selector (for example the generic promoter PS); *the desired protein generator downstream of K081000 and K081001 (for example the generic RBS-GOI-T generator); false false _227_ 0 2583 9 In stock true We used BioBrick Standard Assembly. true Lorenzo Pasotti, Paolo Magni component2261685 1 BBa_B0030 component2261681 1 BBa_C0061 component2261690 1 BBa_C0078 component2261700 1 BBa_R0079 component2261695 1 BBa_B1006 component2261678 1 BBa_B0030 annotation2261681 1 BBa_C0061 range2261681 1 22 639 annotation2261700 1 BBa_R0079 range2261700 1 1416 1572 annotation2261690 1 BBa_C0078 range2261690 1 694 1360 annotation2261695 1 BBa_B1006 range2261695 1 1369 1407 annotation2261678 1 BBa_B0030 range2261678 1 1 15 annotation2261685 1 BBa_B0030 range2261685 1 673 687 BBa_R0079 1 LasR+PAI Promoter (LasR & PAI regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z "Analysis of the Pseudomonas aeruginosa Elastase (lasB) Regulatory Region". Lynn Rust, Everett Pesci, and Barbara Iglewski Released HQ 2013 Binding region for LasR protein (positive regulation) false true _1_ 0 24 7 In stock false true Alvin Carter Powers (Fighting Darwins) annotation300985 1 OP2 range300985 1 46 63 annotation318496 1 -10 range318496 1 140 145 annotation300992 1 OP1 range300992 1 106 125 annotation318495 1 -35 range318495 1 117 122 BBa_C0061_sequence 1 atgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_K081003_sequence 1 attaaagaggagaaatactagatgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctctactagagattaaagaggagaaatactagatgatcgttcagatcggtcgtcgtgaagagttcgacaaaaaactgctgggtgaaatgcacaaactgcgtgctcaggttttcaaagaacgtaaaggttgggacgtttccgttatcgacgaaatggaaatcgacggttacgacgctctgtccccgtactacatgctgatccaggaagacaccccggaagctcaggttttcggttgctggcgtatcttcgacaccaccggtccgtacatgctgaaaaacaccttcccggaactgctgcacggtaaagaagctccgtgctccccgcacatctgggaactgtcccgtttcgctatcaactccggtcagaaaggttccctgggtttctccgactgcaccctggaagctatgcgtgctctggctcgttactccttgcagaacgacatccagaccctggttaccgttaccaccgttggtgttgaaaaaatgatgatccgtgctggtctggacgtttcccgtttcggtccgcacctgaaaatcggtatcgaacgtgctgttgctctgcgtatcgaactgaacgctaaaacccagatcgctctgtacggtggtgttctggttgaacagcgtctggctgtttccgctgctaacgacgaaaactacgctctggttgcttaataactctgatagtgctagtgtagatctctactagagaaaaaaaaaccccgcccctgacagggcggggtttttttttactagaggcccctcgctgagcgcgtcccggagctgggggcaacctagctgccacctgcttttctgctagctattccagcgaaaacatacagatttccggcgaaatcaaggctacctgccagttctggcaggtttggccgcgggttctttttggtacacgaaagc BBa_C0078_sequence 1 atgatcgttcagatcggtcgtcgtgaagagttcgacaaaaaactgctgggtgaaatgcacaaactgcgtgctcaggttttcaaagaacgtaaaggttgggacgtttccgttatcgacgaaatggaaatcgacggttacgacgctctgtccccgtactacatgctgatccaggaagacaccccggaagctcaggttttcggttgctggcgtatcttcgacaccaccggtccgtacatgctgaaaaacaccttcccggaactgctgcacggtaaagaagctccgtgctccccgcacatctgggaactgtcccgtttcgctatcaactccggtcagaaaggttccctgggtttctccgactgcaccctggaagctatgcgtgctctggctcgttactccttgcagaacgacatccagaccctggttaccgttaccaccgttggtgttgaaaaaatgatgatccgtgctggtctggacgtttcccgtttcggtccgcacctgaaaatcggtatcgaacgtgctgttgctctgcgtatcgaactgaacgctaaaacccagatcgctctgtacggtggtgttctggttgaacagcgtctggctgtttccgctgctaacgacgaaaactacgctctggttgcttaataactctgatagtgctagtgtagatctc BBa_B0030_sequence 1 attaaagaggagaaa BBa_B1006_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_R0079_sequence 1 gcccctcgctgagcgcgtcccggagctgggggcaacctagctgccacctgcttttctgctagctattccagcgaaaacatacagatttccggcgaaatcaaggctacctgccagttctggcaggtttggccgcgggttctttttggtacacgaaagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z