BBa_K090502 1 BBa_K090502 Gram-Positive Xylose-Inducible Promoter 2008-10-27T12:00:00Z 2015-06-09T09:03:37Z We PCRed this part out of the pSG1154 gram-positive shuttle vector, acquired from the Bacillus Genetic Stock Center (bgsc.org), catalog number ECE153. This is a Xylose-inducible promoter for use with gram-positive organisms. It requires a downstream gram-positive ribosomal binding site and coding sequence to function. We only have experience using this part in B. subtilis, but it should function in most gram-positive organisms. It has not been tested and will most likely not work in E. coli. false false _188_ 4206 3501 9 Not in stock false We used the following PCR primers to extract the part, sans biobrick ends: Forward: TTCATGAAAAACTAAAAAAAATATTG Reverse: TATGTCATATTGTAAGTAAGTTGCAC false Daniel Goodman annotation1991916 1 -10 range1991916 1 53 58 annotation1991917 1 Xylose Repressor Binding Region range1991917 1 68 91 annotation1991895 1 -35 range1991895 1 30 35 BBa_K090502_sequence 1 agatctttcatgaaaaactaaaaaaaatattgaaaatactgatgaggttatttaagattaaaataagttagtttgtttgggcaacaaactaatgtgcaacttacttacaatatgacataaaatgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z