BBa_K091105 1 BBa_K091105 pTet/Mnt Hybrid Promoter 2008-06-18T11:00:00Z 2015-05-08T01:08:37Z This part comes from the Mnt promoter and the TetR promoter This promoter is a modified version of the Mnt promoter that is also responsive to TetR. The promoter should be repressed by Mnt repressor. It should also be repressed by TetR, and in the absence of Mnt repressor, should be induced by aTc. false false _191_ 0 3080 9 It's complicated true Mnt repressor binds as a tetramer to two half-operator sites. Introduction of TetR binding sites between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by TetR. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3??? to -10: gagtcgtattaattt will be replaced by tccctatcagtgata, and 2) truncate the second half of ptet -10 and mutate -35 so that it function to bind tetR (replace ttgaca with actgta), but is not a promoter, and 3) place the tetR1 and tetR2 binding sites 3??? to truncated mnt -10 sequence. true Robert Cool annotation1963739 1 -10 range1963739 1 47 52 annotation1963742 1 Mnt range1963742 1 1 52 annotation1963740 1 tetR1 range1963740 1 53 71 annotation1963741 1 tetR2 range1963741 1 78 98 BBa_K091105_sequence 1 ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagttccctatcagtgatagagaactgtaatccctatcagtgatagagat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z