BBa_K091106 1 BBa_K091106 LsrA/cI hybrid promoter 2008-06-18T11:00:00Z 2015-05-08T01:08:37Z The Missouri Western/Davidson team designed primers for LsrA and extracted the DNA from E. coli MG1655. The CI portion was pulled from the registry as part number R0051. This hybrid promoter uses the LsrA promoter that is capable of being repressed by LsrR - induction can occur with phospho-AI-2. Binding sites for cI repressor also occur. As a result the promoter is off in the absence of AI-2 and on in the presence of AI-2, but always off in the presence of cI. false false _191_ 0 3129 9 It's complicated false The promoter region for LsrA should remain unaltered while cI binding sites (OR1 and OR2) are introduced downstream. The OR2 sites with cI bound should not allow transcription. The cI binding sites have a natural 6 bp spacer between them. It would be desirable to position the cI binding sites immediately downstream of the -10 region of the LsrA promoter. However, experimental evidence for the transciption start (+1) appears to be lacking. false Andrew Gordon BBa_K091106_sequence 1 aaccgtgaaaatcaaaatagcataaattgtgatctattcgtcggaaatatgtgcaatgtccacctaaggttatgaacaaattaaaagcagaaatacatttaacaccgtgcgtgttgatttatctaacaccgtgcgtgttga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z