BBa_K094140 1 BBa_K094140 pLacIq 2008-10-12T11:00:00Z 2015-05-08T01:08:40Z point mutation made from E. Coli genomic lacI gene promoter mutant promoter of lacI gene, which enables high level of lacI protein expression false false _255_ 0 2589 9 Not in stock false no specific considerations false Liu Chenli annotation1981123 1 pLacIq range1981123 1 1 80 BBa_K094140_sequence 1 ttgacaccatcgaatggtgcaaaacctttcgcggtatggcatgatagcgcccggaagagagtcaattcagggtggtgaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z