BBa_K1015012 1 BBa_K1015012 mhpA homology sequence(for RED recombination system) 2013-09-15T11:00:00Z 2015-05-08T01:08:42Z Escherichia coli MG1655 mhpA gene This sequence is 360bp homologous sequence with Escherichia coli mhpA gene. Bacteriophage λ recombination system(RED system) can cause homologous recombination between this sequence and mhpA gene. Because of the recombination, Biobrick part can be inserted into E. coli genome. false false _1321_ 0 13704 9 Not in stock false Genome insertion false Marina Ikeno BBa_K1015012_sequence 1 aaggtagcctgatatgcacgcttatcttcactgtct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z