BBa_K102911 1 BBa_K102911 TA13 gate from synthetic algorithm v1.2 2008-10-25T11:00:00Z 2015-05-08T01:08:46Z Synthetic This design incorporate stem bulges and YUNR sequence in the loop (5' UUGG) as per Isaacs et al, 2004 to improve RNA stability and susceptibility to anti-sense induction. false false _181_ 0 2647 9 Not in stock true See Team wiki (2008 Alberta_NINT) Project page for description of algorithm false Wayne Materi annotation1990306 1 stem_loop range1990306 1 23 75 BBa_K102911_sequence 1 caatagatcattgggatccgtgtcacgcctccttcgtcccgtcgcattggttcgcgtgggagcgaaggaggcgtgttttattttccatgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z