BBa_K102951 1 BBa_K102951 TA1In anti-sense input to TA1 (BBa_K102901) 2008-10-25T11:00:00Z 2015-05-08T01:08:46Z Synthetic This provides the anti-sense input to disrupt (and thereby activate) the TA1 gate (BBa_K102901). Tha actual transcript includes two flanking hammerhead ribozymes (Taira et al, 1991) which selve cleave to release the anti-sense RNA. false false _181_ 0 2647 9 Not in stock true See Team wiki (2008 Alberta_NINT) Project page for description of algorithm. false Wayne Materi annotation1990316 1 TA1In anti-sense RNA range1990316 1 77 91 annotation1990317 1 hammerhead 2 range1990317 1 97 157 annotation1990315 1 hammerhead ribozyme 1 range1990315 1 13 76 BBa_K102951_sequence 1 ggagggatcattgtcgagctctgatgagtccgtgaggacgaaacggtagacagtaccgtcagctcgacaagctttcgcatcttccgggggcaactactcgagatccgtcgaccagtcatgcctggtcctgatgagtccgtgaggacgaaacggatca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z