BBa_K102961 1 BBa_K102961 TA13In anti-sense input to BBa_K102911 2008-10-25T11:00:00Z 2015-05-08T01:08:46Z synthetic This provides the anti-sense input to disrupt (and thereby activate) the TA13 gate (BBa_K102911). The actual transcript includes two flanking hammerhead ribozymes (Taira et al, 1991) which self-cleave to release the anti-sense RNA. false false _181_ 0 2647 9 Not in stock true See Team wiki (2008 Alberta_NINT) Project page for description of algorithm false Wayne Materi annotation1990333 1 hammerhead ribozyme 1 range1990333 1 14 75 annotation1990335 1 hammerhead ribozyme 2 range1990335 1 111 171 annotation1990334 1 TA13In anti-sense RNA range1990334 1 77 106 BBa_K102961_sequence 1 ggagggatcattgtcgagctctgatgagtccgtgaggacgaaacggtagacagtaccgtcagctcgacaagctttcgaaccaatgcgacgcgacgaaggtggcgtaactactcgagatccgtcgaccagtcatgcctggtcctgatgagtccgtgaggacgaaacggatca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z