BBa_K1033240 1 BBa_K1033240 Signal peptide from Lactobacillus reuteri cell surface protein 2013-08-22T11:00:00Z 2015-05-08T01:08:49Z Isolated from the genom of Lactobacillus reuteri DSM 20016 [1] 1. http://www.ncbi.nlm.nih.gov/protein/184153613 The first 50 amino acids of the cell surface protein [1] from Lactobacillus reuteri DSM 20016. The start in this entry is however wrongly identified. The real start is about 20 nucleotides downstream. This signal sequence has only been identified as a potential signal peptide with SignalP 4.1 Server [2]. 1. http://www.ncbi.nlm.nih.gov/protein/184153613 2. http://www.cbs.dtu.dk/services/SignalP/ false false _1340_ 0 18318 9 Not in stock false The part is designed according to the Freiburg [1] standard to enable fusion with other proteins. Only the 3' end designed according to this standard as a signal peptide always is fused to the 5' part of a protein. The 5' end is also designed with a B0034 RBS [2]. false Anton Berglund BBa_K1033240_sequence 1 aaagaggagaaatactagatgctatcaagaaaaaattataaggaaactatacgaaaacagacacctacaaaacagtactatactattaagaaattaactgttggggttacttcggtattaattggtctatcctttatgggagaactagaaggggatagcgttcatgcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z