BBa_K104008 1 BBa_K104008 pSpaS 2009-10-13T11:00:00Z 2015-05-08T01:08:51Z The part is derived from the genome of Bacillus subtilis ATCC6633 and described by: Kleerebezem M, Bongers R, Rutten G, de Vos WM, Kuipers OP. Autoregulation of subtilin biosynthesis in Bacillus subtilis: the role of the spa-box in subtilin-responsive promoters.Peptides. 2004 Sep;25(9):1415-24 This promoter is regulated by the subtilin responsive regulator spaR. false false _237_ 0 2652 9 Not in stock false This promoter forms part of the complex device BBa_K104001 false Anil Wipat annotation2040680 1 pspaS range2040680 1 1 79 BBa_K104008_sequence 1 gatcttaaaaaaaggaaaaaattgataaaatcttgatatttgtctgttactatttaggtattgaaaggaggtgaccacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z