BBa_K105023 1 BBa_K105023 lac I - operator 2008-10-25T11:00:00Z 2015-05-08T01:08:52Z from oligos This BioBrick is the lac I recognition site. It can be used for the construction of promoters which should be regulated by activators or repressors containing a lac I DNA binding domain ([[Part:BBa_K105006| BBa_K105006]]). <br> <br> false false _253_ 0 3313 9 It's complicated false This BioBrick contains the consensus sequence plus 5 spacer nucleotides on each side. The spacer is directly followed by the restriction site without a base in between. So when you construct multiple operator sites from this basic part you will have 16 bp between two consensus sequences. false Katja Karstens annotation1989125 1 consensus sequence range1989125 1 6 20 BBa_K105023_sequence 1 atttacttgtgagcggataaacgta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z