BBa_K105026 1 BBa_K105026 Gal1 promoter 2008-10-25T11:00:00Z 2015-05-08T01:08:52Z yeast genomic DNA Released HQ 2013 This is an aquivalent to [[Part:BBa_J63006| J63006]]. We reconstructed this BioBrick because the length of the part we received from the registery didn't correspond to the J63006. Neither the sequence from the MIT sequencing did. <br\n> false false _253_ 0 3313 9 In stock false This BioBrick ends with a Kozak sequence. To enable the direct fusion with DNA coding domains in frame the vector of this BioBrick has no base pair in between the restriction sites and the BioBrick. <br\n> For more information about this issus, see:<br\n> Phillips, I.E. and Silver, P.A. "A new Biobrick Assembly Strategy Designed for Facile Protein Engineering." <br\n> DSpace http://hdl.handle.net/1721.1/32535 (2006). false Katja Karstens annotation1989379 1 Kozak sequence range1989379 1 532 549 BBa_K105026_sequence 1 ccccattatcttagcctaaaaaaaccttctctttggaactttcagtaatacgcttaactgctcattgctatattgaagtacggattagaagccgccgagcgggtgacagccctccgaaggaagactctcctccgtgcgtcctcgtcttcaccggtcgcgttcctgaaacgcagatgtgcctcgcgccgcactgctccgaacaataaagattctacaatactagcttttatggttatgaagaggaaaaattggcagtaacctggccccacaaaccttcaaatgaacgaatcaaattaacaaccataggatgataatgcgattagttttttagccttatttctggggtaattaatcagcgaagcgatgatttttgatctattaacagatatataaatgcaaaaactgcataaccactttaactaatactttcaacattttcggtttgtattacttcttattcaaatgtaataaaagtatcaacaaaaaattgttaatatacctctatactttaacgtcaaggaggaaactagacccgccgccaccatggag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z