BBa_K105027 1 BBa_K105027 cyc100 minimal promoter 2008-10-25T11:00:00Z 2015-05-08T01:08:52Z Amplification from the plasmid pAH3. This is the core of the CYC1 promoter of ''S. cerevisiae''. This promoter element allows basal transcription. The transcription signal can be modulated by adding operator sites upstream of this BioBrick. In that way activators or repressors can act on the transcription machinery. <br> <br< false false _253_ 0 3313 9 It's complicated true This BioBrick contains the TATA-box and most of the 5'UTR (-139 to -36, relative to the translational start)of the natural CYC1 promoter. A Kozak sequence is not included and has thus to be added! true Michael Wild annotation1989774 1 TATA box range1989774 1 17 23 BBa_K105027_sequence 1 gcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttctat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z