BBa_K1051702 1 BBa_K1051702 SRC1 Intron+CGG 2013-06-29T11:00:00Z 2015-05-08T01:08:55Z From SRC1 Intron from SRC1 with additional CGG at 3' Can be spliced into two different forms(5'L or 5'S) by regulating the presence of Hub1 or Bud31 false false _1358_ 0 15920 9 In stock false No false Yang Zhou BBa_K1051702_sequence 1 gcaagtgagtacaatttattatcttacaaaaattattaaacctgttattatatgataacagttttaattttttttgaatttttttttgtttttgatttatttactaacatcttttcctaattttctctagcgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z