BBa_K1059010 1 BBa_K1059010 RBS J23106+mamI coding squence 2013-09-15T11:00:00Z 2015-05-08T01:08:57Z It comes from Magnetospirillum magneticum AMB-1 bacteria strain.We firstly design primers to get this gene squence by PCR from genome, and then use another primer to add RBS J23106, prefix and sufix onto it. mamI is a protein coding squence from Magnetospirillum magneticum AMB-1 bacteria strain, mamAB gene cluster. It will guide the construction of MMB with mamL, mamB, mamQ, mamK, which we use to construct the intracellular compartment. false false _1367_ 0 15604 9 It's complicated true Because synthetic biology proposes standard prefix and sufix, so we add prefix and sufix by PCR before we ligease it onto plasmid PSB1C3. false Wenjun Wang annotation2347052 1 BBa_J23106 range2347052 1 1 35 BBa_K1059010_sequence 1 tttacggctagctcagtcctaggtatagtgctagcatgccaagcgtgattttcggactgctggcgcttgccctcggattgctgggggtgacggcatggtggtggtcggtgaccgagttcctgcgcggagcggtgccggtggccctgctcatccttggcttggtcgcgttggcctccggggtgcaatccgtgcggttgcctcgttccaacaaggggaccgcttcagaccctgacatcgatggttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z