BBa_K1061001 1 BBa_K1061001 apoptin 2013-09-10T11:00:00Z 2015-05-08T01:08:58Z Cloning from plasmid from Zhuang's lab. Apoptin is a protein that is originally isolated from the chicken anemia virus(CAV). It has been found that expressing this gene can induce apoptosis in a broad spectrum of cancer cells but not in normal cells. Hence it is a very powerful tool in treating cancer. Fusion the TAT protein with apoptin can even achieve by-stander effect, and we try to use it in the most simple device of our project. We have successfully expressed it in Hep G2 cell lines and observe a brilliant apoptosis effect. false false _1369_ 0 11892 9 In stock false Although it has been try in a broad spectrum of cells and prove to be safe to the normal cells, it still has not been tried in ALL normal cells. So before using it to treat certain kinds of cancer, every team need to ensure that it want hurt the specify normal cells involve in the project. And it is a protein contain 121 amino acid that may big enough to induce immune reaction(although in the experiment of mouse it has not been reported.) false mengyi sun annotation2339023 1 leucine rich fragment range2339023 1 97 138 annotation2362082 1 NLS 1 range2362082 1 244 264 BBa_K1061001_sequence 1 atgaacgctctccaagaagatactccacccggaccatcaacggtgttcaggccaccaacaagttcacggccgttggaaacccctcactgccgagagatccggattggtatcgctggaattacaatcactctatcgctgtgtggctgcgcgaatgctcgcgctcccacgctaagatctgcaactgcggacaattcagaaagcactggtttcaagaatgtgccggacttgaggaccgatcaacccaagcctccctcgaagaagcgatcctgcgacccctccgagtacagggtaagcgagctaaaagaaagcttgattaccactactcccagccgaccccgaaccgcaaaaaggcgtataagactgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z