BBa_K106400 1 AD default Default insert for AarI AD acceptor vectors 2008-11-24T12:00:00Z 2015-05-08T01:08:58Z AarI AD acceptor vectors Default insert for AarI AD acceptor vectors. It includes the AarI restriction sites but not the 4 bp D or A overhangs. false false _226_ 0 2659 162 It's complicated false It includes the AarI restriction sites but not the 4 bp D or A overhangs. false Sergio Peisajovich annotation1999684 1 Aar I recognition site range1999684 1 42 48 annotation1999683 1 AarI recognition site range1999683 1 5 11 BBa_K106400_sequence 1 caaggcaggtggacaagaggagtcccgggagctggaactcccacctgcaaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z