BBa_K1074005 1 BBa_K1074005 LTB 2013-09-12T11:00:00Z 2015-05-08T01:09:02Z ? This eltB gene encodes for the Heat-labile enterotox(LT) in certain virulent strains of E.coli.However,in vitro,like Chinese Hamster Ovarylera toxin B subunit (CTB), it is an efficient mucosal adjuvant and carrier molecule for the generation of mucosal antibody responses and induction of systemic T-cell tolerance to linked antigens. So we use it to enhance the immune response to our transdermal vaccine. false false _1383_ 0 17588 9 Not in stock false ? false Yali Peng BBa_K1074005_sequence 1 gctccccagtctattacagaactatgttcggaatatcgcaacacacaaatatatacgataaatgacaagatactatcatatacggaatcgatggcaggcaaaagagaaatggttatcattacatttaagagcggcgcaacatttcaggtcgaagtcccgggcagtcaacatatagactcccaaaaaaaagccattgaaaggatgaaggacacattaagaatcacatatctgaccgagaccaaaattgataaattatgtgtatggaataataaaacccccaattcaattgcggcaatcagtatggaaaactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z