BBa_K1074012 1 BBa_K1074012 Pgrac promoter 2013-09-15T11:00:00Z 2015-05-08T01:09:02Z From plasmid PHT43 Prgac promoter(consisting of the groE promoter,the lacO operator and the gsiBSD sequence) allow induction by addition of ITPG,While the background level of expression of these expression cassettes is very low in the absence of the inducer, an induction factor of about 1,300 was measured using the bgaB reporter gene (Phan et al.,2005). The amount of recombinant protein produced after addition of IPTG may represent 10 and 13%, respectively, of the total cellular protein (demonstrated when fusing the htpG and pbpE genes to the groE promoter; Phan et al., 2005). false false _1383_ 0 16001 9 Not in stock false NO false Changlong Zhao BBa_K1074012_sequence 1 ggtaccagctattgtaacataatcggtacgggggtgaaaaagctaacggaaaagggagcggaaaagaatgatgtaagcgtgaaaaattttttatcttatcacttgaaattggaagggagattctttattataagaattgtggaattgtgagcggataacaattcccaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z