BBa_K1074013 1 BBa_K1074013 promoter sdpR/I 2013-09-15T11:00:00Z 2015-06-08T02:58:23Z from the genome of Bacillus subtilis WB800N This part is a sigma factor A-dependent promotor of the gene sdpR derived from the B.subtilis ,and it contains an operon for the signaling pathway of sdpc,a bacterial toxin of B.subtilis. It's activated as the toxin sdpC existed,while the natural pructrue of the promotor, sdpR/I ,confers immunity to the SdpC toxin. Cells of B. subtilis enter the pathway to sporulate under conditions of nutrient limitation could generate sdpC, then this promotor would be activated. We use this part to overexpress sdpC toxin in spore-forming cells,to build a self-killing system in B.subtilis for safety thinking. false false _1383_ 4206 16001 9 In stock false NO false Changlong Zhao BBa_K1074013_sequence 1 gggttgtttttaaaaaaattcaagttataatgaaaataatacatttatacaaatatctaaatgtctaaatgttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z