BBa_K1075020 1 ssrA(DAS+4 E. coli ssrA(DAS+4) 2013-09-22T11:00:00Z 2015-05-08T01:09:02Z PCR amplification from gene synthesis fused to the C terminus of a protein it triggers degradation upon induction of sspB function. false false _1384_ 0 12108 9 Not in stock false we used the E. coli ssrA tag with a weakened interaction with ClpXP and a linker of 4 amino acids in between to optimize degradation speed increase upon induction with sspB. [1] false Max Schelski BBa_K1075020_sequence 1 gcagctaacgatgaaaactacagcgaaaactatgctgacgctagctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z